288 Low Res Scan CAs May 2006

PrimerName_FChr numberPosition_cMForward Primer SeqPrimerName_RChr. NumberPosition_cMReverse Primer Seq
Fz939414.7GGCCTCACACAATTTCAAATRz939414.7GAGACGAGCAGAAGTCCCTG
Fz9704147CACGATGGCACAAAAATCTGRz9704147AAATCTTGGATGCGTATCGG
Fz22347174GAGCAGCAGAGAGCAGGAGTRz22347174TTGGTGTTTGCTGTCCTCTG
Fz7634215ATTGAGGAAGTGGGTGCAACRz7634215TCACTTTCCCACCCTTCTTG
Fz4469223.7TCAGCTGACACTCGATCACCRz4469223.7TCAGCTGACACTCGATCACC
Fz6617258ACCGATGGGAACAATAAAAGARz6617258ATCGATGTATTGTGCAGTGTCC
Fz87238.4CTTAAAGCCCAGTGAGGCACRz87238.4ATGCCTGGTAATGAGCAGCT
Fz9964354TGGCTGTCTATGAGGTATGGCRz9964354GACGACAGAACACAGCAACG
Fz60193103GCAGTGTCAATACTTGCTCTCGRz60193103ATCCTCTGAGAAACCAGACAGC
Fz7490430TGGTGGATGTGTTCACGACTRz7490430TGTAAGTCCTTCAGAAGAGGCA
Fz1366465TACTTCAGCTTCATCCAGACCARz1366465CTGAACTCTGAGTCCAGACCG
Fz3902510.7GCCACCATGCCACCACATAARz3902510.7CAGGCGAGCCTTGGAAAGAA
Fz10456536GTGGATGACCACTGAGCAAGRz10456536ACCCTCAGCTGCTCTCTGAG
Fz4299580AGGAATGCGCTATGGGACGARz4299580CACATCTGCCACTGAACCGG
Fz74060AAACTTTGCTGCTCTTCCTCCRz74060CTCTGTCAGGTCCTGTGATCC
Fz5294654AGGGCGGCGAAATTGAAATTRz5294654AGCTCTAACCCCCTCCAAGCA
Fz4297688AGACTCACCATGGCTTGCTCGRz4297688TGTGCAGAGGAACAGCCCTG
Fz17771.9?GGAAACTCTCACGCTCGTTCRz17771.9?ACGGATGTTCCTGTAAACGC
Fz1206723CGTCTGACAGCCTGCATGRz1206723CTCGGCGCAGTAGGGAAC
Fz8156759GGCAATGGACTCTTTCAAGCRz8156759GTTTCATGGCTTACATGCCC
Fz5563795TGCAGGTTGTTCGGTCCTGARz5563795TCACAATGCACACAACCCCC
Fz9420819.8CGCCATACAGCAGAAACTCARz9420819.8TGGCCAGTGCTGATTTATTC
Fz4323830TCTGTCCTCTCGTCCCCGAGRz4323830AAATTAGCACACGTCGCGCA
Fz4318876GACCTAATAAAGTGGCCGGTRz4318876TGGTGAAAGCGCCCATCTTT
Fz177793.5TGCGCAAGACCTGGCTGGACRz177793.5TGGCTGCCTGCAGAATACAA
Fz5080944AGAACACACACAGCGTGACCTCRz5080944ATGGGAAGAACACCCCCACG
Fz1270991GCAGGTTTACAGCGCACTGGRz1270991GAAGAGTTCAGTAACACAAGTCC
Fz6410108.7TCTGATTATTCTCACCTGCCGRz6410108.7ATCAAACACATCTGCTCCCC
Fz112291061GCAGGAAAGCCAGAATGAAGRz112291061CACAAGACAGCGAACAGGAA
Fz3527113.6TTCTGGTGTTTTCCAGCGGARz3527113.6GGCAGTTCGTCACCTCAAAACA
Fz134111150CCATCCGTCTTTCTGCTCTCRz134111150CCAGCTCTGTGTGTTTGGAA
Fz1778122.3AAGCTGGCGTGAAGAATATTGGRz1778122.3CAGGAGTTGATGCCAGCGGG
Fz48301253TGTTTCCTTTTGCCTGTATGGRz48301253TTTGGGGCAATAGGTGAAAG
Fz61041321TCAGACTTCTGTTTGCCCGRz61041321CATGTGCCTATTGCCAACTG
Fz132501343GCTGACAGCGGACTTAAAGGRz132501343CCAAGATCTCTGGAATCCCA
Fz66571353TGTGTCCCAGCAATCATTGTRz66571353GGATCACATGTGCGATGAAG
Fz1523140GATCACAGCCGCTTCGTCAARz1523140CCAAACCATTCAGACTGGATGA
Fz54351432CCTTGTGCCCCTCAAATGCGRz54351432GTCATGGGAGGGAATGGTGC
Fz66661478TGCTGCTGATGATGTGACAARz66661478TTTAATAGGTCACAGCACACGC
Fz10289150CACCATATATGTGTTGTTCTGCARz10289150CGACACATCACGCCATTTAC
Fz219821527TGGAAAAACATGAATGCTGCRz219821527AACACCTGCTGGGTAAGTGC
Fz132301560TATGAAAAGGCACTTGATGTGGRz132301560TCTGCGCAGTAATAGCAAACA
Fz52231591AACAGAGCCGATCTGCCACCRz52231591AGCACAGCGGAGGAAATAAAGC
Fz1642164.8ATACAGGCGGTCAGGAACAGRz1642164.8CGGTGCAGGACTCACACTAC
Fz211551616GAAGCTTGTTTGGGTTTGGARz211551616CCACAAAGGCGAAGACATTA
Fz12151644TCCTGTGATGTACAGCCTGGRz12151644GAACCAAGCCCTCGCTTC
Fz4268171.1GCTGCGTTACTCACCGAGAGGRz4268171.1AGCCAGCTGAATTCCTGAAAGC
Fz98471739GGGCCAGACCAATTAGAACARz98471739GTGTTGGCTGCTCAGTTCAA
Fz19281780GATGACGACATGAACCTGGGCRz19281780CCACAACACCCTCCAGACCC
Fz1144182.4CTCCTCTCCGGGATACACACRz1144182.4ACCACGAGTCTGAGTGCTGA
Fz100081840AAGCCAAACTGATGGGTACGRz100081840GGCTCCTTTGATGTCCCATA
Fz52311815.7TCTGTCCTTGTTCGTCCTCCRz52311815.7CGGATCACATCAAACCTGTG
Fz1625191.1TGGGATACCTGACATCCAGACCRz1625191.1GCTTGAGTGAGGACGCGGTT
Fz74501922TCTCACTCATCCAGATCATCTATCARz74501922TCACTGGTAAACACTGTCAGCA
Fz66611957CCTCCAGGATCCTGCAGAAARz66611957TTCTCTGACTGCCCTCGG
Fz8554209.5CGGTAAATCAGTCCCAGCATRz8554209.5ACCTCTGCAGGACTGAGGAA
Fz39642051GCCATTTTTCTTGCTGCAATCARz39642051TGCATGCCATAACAAACACTGG
Fz38242055.7AACAACCGCTTAGATGTGCARz38242055.7TTCCCGTTTAAAACCCATGA
Fz97082096GAGCGGCAAGTATGTGGATTRz97082096AGGAGGCGAATCAGACTGAA
Fz3476210GGAGAGCTGCACCGTGAACARz3476210GCCGGAAACCGCAAGTGTAG
Fz109602138TCCCCGCTGAGTCCTCTATARz109602138AGTGTGCGAGGTGTGTCAAG
Fz11752220CTGATGACGAAATACCGGCTRz11752220GCCACAGCTCTTCATCTATATTG
Fz2302229GGTTCTCCCACCAGCACTAARz2302229CGACTCAGACTTACTGGTGTGC
Fz98172262AATCAGGTCAAAATCTGTCAGGRz98172262GTAACGCTGTACAGACCCCC
Fz40032317AGCAGGGGGATTCCTGCATTRz40032317AAGTTGGCCAATATGGTCTGCG
Fz17732360CATGATGCTGCCCATCGTCGRz17732360ATTCCTCATGTGGCGACCAA
Fz35252348?TTCTCTGCGGGGTGGTTTTCRz35252348?TGCTTTTTCAGGATTGCAGCC
Fz15842413ATAATGAACGTTTGGCGAGGRz15842413AAGGAAGTCTTTGTGAATTGACG
Fz98522437ACAGCTCTTCTCCAGCAGGARz98522437GTGCCTTCCAATAAAGCCAA
Fz223752458ATGTGGAAGCGATTAGCACCRz223752458AAGCTGCCTTCACTTCCTCA
Fz1378250.8TGGAGGAATGAGGACAGCAGGRz1378250.8ACCGTGTTGACAATCGATCAGC
Fz56692552TGTTGATCATCAGTTGCAGTGCRz56692552GCCTCTGCAAACAAGTTTCCG
Fz9217113.4GCCCAGCCCTCTGTACATTARz9217113.4AGGAGAATCGCCATTTCTTG
Fz1705124CCACAGCGGACACTTTGAACCRz1705124CAAGGTTTACCACGGGACTGA
Fz6802157AGACTGAAGTGCACTGTTGTCCRz6802157CTCCGACGCGATCATATTAA
Fz427820ATCCTGTCCACTGCTGCATCARz427820ACATTGCTAATGAGTGGCGCC
Fz3430236AGAAACGCAAACGCCCACATRz3430236TTTAAATGCAGCCCACGGCT
Fz1703279GCTAGCCAATGTAGTCGAAGGCRz1703279TTTCCAAGGGGTCAGTGAGC
Fz15457336TCGCCCCATTATTTTATACACCRz15457336CTTTCTTCATTTCCTGTCACCC
Fz3439345.5CTGCAGCGAATGAGCAGGAARz3439345.5TTGTGAGCTCAGGTGGCCTG
Fz20058381GGTGTTTCGTCCACTGTTGARz20058381TAACTTTTCAAACGGGACGG
Fz327540TTATTAACACAGACAGCCGGGRz327540CAGACAGATGCAGACCCTCA
Fz9920439GCTGCTGAGTTGTGGTCTTGRz9920439TGCCCTTAAATCATACAAAATTACA
Fz20450461.6CCAAATCTACGCCCATGTCTRz20450461.6CGACCTCTGAATCTGCCTTT
Fz11496514GAGCACAATAAAAGTCCCGCRz11496514TGCTTCAGAAAAGCACATGG
Fz3804562CACGTGCTCAGAGCTCCAGCRz3804562GTGAAGCGCGTGCACATAGG
Fz16775100CCGTGAGAGACGGAGATCATGRz16775100GACAGGTCACACGGATCAAACG
Fz880625TGATCTGAGACGTCTGCCGRz880625GCGCTCTGACAGTGCTTACA
Fz20932645.5TGTGGAAATGAGGAAAAGGCRz20932645.5CTGGTGTCAGACAGAGCCTG
Fz7666673ACAACGCAGCATCATCTCTGRz7666673CAGTCATCCTGGACTGCTGA
Fz327370GCAGACACAACTGACGCATTRz327370CACCCAGATGTGATTTGCTG
Fz1182743GAGCAGACACTTTACATTTTGTGGRz1182743GACACTTACAAAGAGTCTTTCATTTCC
Fz10487753.4TGCATGTTGCGTTTTGTTTTRz10487753.4GGTTGCCAAGCCAAGTTTAA
Fz13880782TCCTTGCTTGGAAGAAGAGCRz13880782AGGGAAAGACACTGAGCGAA
Fz106888.1GGTGAGAAACACAAGAGCAGCRz106888.1CAGACCCAGATTCTTCAGCC
Fz21115857AAGGTTTCTCAATGCCAGAARz21115857CATCCTTGCTTTGGTCACAA
Fz10929893GCACACCATCATGATTGAGGRz10929893TGTGTTTCATCACGGTTTGC
Fz6268919ATCAAAGACTCGCACACGCRz6268919CCTTTCCACCCCTGACTGAC
Fz20031959TGTCAGTGATCTCTGGGCAGRz20031959CTAACGCCCTGTCCTCAGAG
Fz7807978.5TGACATCACTGTTGGGGAAARz7807978.5GCAAGTCAGCTGACGGGTAC
Fz81461028AGCGGAGATGATGACTTGGTRz81461028TCCGCCTCTAGAGAGACTGC
Fz38351048.7TCACCATTTTCACAAATTGGCARz38351048.7AAATGGAGATTCCGCTAAAGCA
Fz32601093GCTGGTCTTCATCCCAGAATGGRz32601093TGGTCGGTGAGTTTTTACAGCC
Fz41901133CCATGGAAAAGGCTGGTTATGGRz41901133TCCACGTTTCCAGGTGAAAATG
Fz80321156.6TGTCAAACGTCAGAAACAAAGGRz80321156.6TGGCCTCTTTCATCAGCAG
Fz109191171CAGGACTCGCGAGAGTTGTTRz109191171GCAATGAGTCACAGAGCGAA
Fz14731229CAACTGGAAGGGCACGAGRz14731229ACTAAACTGGACTAGTTTGCC
Fz13581277TAATGACAGGCTGCACATCTGRz13581277GGAGCAGGGTCTGAGGGT
Fz1531130CATCAGCACTGTGCGTACCTRz1531130CGCTGCTGCCTTCTGTCT
Fz53951335CAGCCCCCTCAGTCACGACTRz53951335CGCGCCCTCTCTGAGAACAT
Fz18261376CGCCACTGTAACGCCACTATAARz18261376TTGAAGACTCCAGAGCCACAAA
Fz8471144.2CGAATGGACTCGTCCTTCATRz8471144.2GAATTTGCATCAGTTTGACTGAA
Fz15361419TCATATCTTTATCTCAGAGATGTGCGRz15361419GCACACATCTGGGGAAAACT
Fz221071456AGCGTTAGTGTGACAGGGCTRz221071456TTTTACAGCGGGGCTTACAC
Fz18011490GATCACTGAGGAAGCGCACCRz18011490CCATCAGTATTTCAGACACCGC
Fz6712158.1GACAAATTGCACCCTCACCTRz6712158.1GCTCGCAGATGTATTGAAAGG
Fz43961542GGGATTGTGGTTCTCCACGCRz43961542AGGCAGCCCTTTCCTAAAGGC
Fz73811573TCCAGTCCACAAAAATGCAARz73811573TGACCACAGCAACTCCATTC
Fz3741160TGCCAATAAAGCACCTCAAACARz3741160GACACCTAGCGGCACAGCAG
Fz7331636GTCTGCCTAATTACGGCCAARz7331636CCAGACCACAGCAAATAGCA
Fz17861674ATCCGCACCGGCCTGGTGAARz17861674AGAGTCACCTCCGCATCTGC
Fz652178.6AGAGAGTGAGCTCTGGAACCCRz652178.6CACTCTTGAAGATGGCAGAGG
Fz220831722GCACATTGTAGCTCGCTCTGRz220831722CTCAGACCACCACCTGTCCT
Fz40531755TGGCGACATCTGCGATGTTTRz40531755GGAAAGCGTCTGCCTCACGT
Fz133291819CCATATGACCTGGCTGGAATRz133291819CCAATGACATGATCACATCGA
Fz53211866TCCTCCACTGAGGTCACTTCCARz53211866TCATAAATTAAACCCCGCCCTC
Fz14171875.4TAGCGGAGACACAGCTCTGARz14171875.4ATTTGGCCGTCAGAATGAAC
Fz4009192.4TAATGGTTGCCCCGTCCATCRz4009192.4TCATGCTGCAAACCCCAGTC
Fz38161937AGATCAGGTGCACAGTGGCGRz38161937CCACTGAAGGGCAAGTGGCT
Fz18031982CAGAACCCTGCTGTTCCAGAARz18031982AGGTGCACCGTCTGGATCTT
Fz39542031AATGGTGTAGAAACCCTGCGRz39542031AAACGCACTAAACATCTCTCTTG
Fz97942076.7TCACCTTCTGAGGAGCAGGTRz97942076.7GTGGCTGCTGGAGCTTATTC
Fz100562079TTGCAATGTGTATGCTGTCAAARz100562079CAAGTGTCCACTCACCCAAA
Fz9532118AGAAAAGAGTGAGGACTGTGTGCRz9532118TGCGAGTTGACAGCCTGTAC
Fz149721121AGCGGCTCGCATCACTATACRz149721121TGTAGAGCCACTCGACACATG
Fz106732213GGCGGGTGACTTGTAGTGATRz106732213AGCGGTGATTTCAGTGCTTT
Fz212432243TCGACATGCCAATAACACGTRz212432243TGACACATTCAGTGGCCATT
Fz132232226.7?TCTGACTTTGCTGAGCTGGARz132232226.7?CCAAGAACCATTAGAAACTGCA
Fz5683231.1CGGATATTGGATTATCGGCTCARz5683231.1AACGATCTGCATGTGCGAGC
Fz44212334TACTAATGGCCCAGGGCGAGRz44212334ACACCCTCCTTCACACCGGA
Fz5075241.1TGTGTTGTCTGATATGCCCACARz5075241.1TGCAAAAAGCCTCTAAGTGCCG
Fz230112435TTGGGGAAAAAGTCTGCTTGRz230112435TCCAACATGTAAAAACCTGACAA
Fz39012471GTCCAATCCCTCAAATCCCTCCRz39012471TTGAACCTGCAGTGTGAAGCG
Fz11092255.1AGCATCAGCCAGACACTCCTRz11092255.1GAACACCAGGATCGCTCCTA
Fz34902536TCTAGTCGGTCCTGAGGCGCRz34902536GCAGGAAACATTGCATGACTCA
Fz92902566GGCGGACAGCACAAGAGTRz92902566CTCTTGTGGTCCAGAACTGTTG
Fz459310GCGGTCAGTTGTTGATCAGTGCRz459310CGTGCATGAAGCGGAAGATG
Fz1351136GGTTAGTGATCAGTTAAGCAATTAGTGRz1351136CTTTCTGAAACAGGGCCAAG
Fz1781182GCTCTGGCAGATTCCAAATTCCRz1781182AAGGGTCAGCTGCAGGGGT
Fz4662231TCCTTTTCAAGGCAGTTGAGGCRz4662231AAGGCAGGAGGTGAGGACAGC
Fz13281245.5ATCACTCTGCCTCCAGCAGTRz13281245.5CTGTCAGTGGGGAACTGGAT
Fz4289269TCATTCAGTGACTCCGTCTCGCRz4289269ATGCAGCCCTCAGACGTTCC
Fz7506313GTCCGTCTCGCTCTCTGATCRz7506313CGCAATGAGTTAAACAGTGTGA
Fz11227355CAGTCATTCCATACACCTGATCARz11227355TCTCTTAATTGGTGCAGGGG
Fz7486387CGAGCAGTTACATCACAGGCRz7486387CACACATGTGCAGCGTTACA
Fz98440TTTCTCAGAGCACAACCTTTAACRz98440GAGAGCAAACTCCAGCTGCT
Fz21636433CTCGCTCACATGAGGACTGARz21636433AGTCTGATTGTGGCCGAGAG
Fz1541451.7ACAGGAACATCTCCTTCCACARz1541451.7ATTTGTCCGACGGGTCACTA
Fz1390550TGAGATTTGAAAAGAGGTTCTGCRz1390550GTTGTGTATGTTACTTCAGCAGTGG
Fz12025100GTCAGGACCATACCCAGAGCRz12025100CAGCGACTGACGGTTCTGT
Fz6624631TTCCCAGAAAACAGCCTCAGRz6624631CTGATCAACATCAAACGCAC
Fz13614668ACCTCGACATGGAGACAACCRz13614668ACAGACGAGGCACACATCAG
Fz1078577.5AGGTGGGCAAACACTCAAACRz1078577.5TGTGAGCATTGGGTCACCTA
Fz1059751AACAGGTGACAGAGCACACGRz1059751GGGAGAGGGCAGGACAATAT
Fz13936784TTGGTGACCAGGGTTTAAGCRz13936784CCACCCTCTTAATTTGGCTG
Fz163480AGCCACAGCGCTGGAGATTCRz163480GTGAGTCCAACACACCGCGT
Fz13412838TGGTAAGGGAAGGAATGACGRz13412838GCCTGTCATACCGCTCTGAT
Fz3526896AGCTGGTGTATTTCGGAGAGCARz3526896CACACACTGACGTGCGGATG
Ffi59h048?GCGTCCGAATAATATTACGTGTGRfi59h048?TTGCCAGATATTGTGCAACG
Fz2086090TGCAGATATCCTCCACGTTGRz2086090CTCCACCTCAGGGTCATTGT
Fz4673932TGTGAGAGACCAAACAGGCAGARz4673932TCTGCTGAGGCTTTGCAGTAAG
Fz10789965ATGCATCACACAGCTGCAGTRz10789965GCGTTTCTCCCAGCTAACAG
Fz136321029AGGATGATGAAGACGGATCGRz136321029TCGCCTGAGGTGAGTTTTTC
Fz172191078CCACAGTCCACCAAGACATGRz172191078GCTACAACACAGCTCGTGGA
Fz1590110CATGTGGCCACAGCAGACRz1590110CAGAGCCAGAGCACTCCTG
Fz13931134AAGCCCATAATCTGAAAACAGCRz13931134TATACAAACAGGTACTGCTGCTCC
Fz33621164AAGAAGCCCTGAGGACAACARz33621164GCCATTGACTGTGCCTGAG
Fz1225124.9CGAGCCGATAATGAATATACAGCRz1225124.9CCACCGTGACACCCTTAATT
Fz41881242GTAGTTGAATGCCGAATTGGCCRz41881242GAACACCTGCGCATCCACAG
Fz103641258.5TACGTGGGCGATGATGTAAARz103641258.5GGCAGACCCCTCACTGTG
Fz136111321GAAACCAAACGAGATCGGAARz136111321TGCATCTAAGATCTATAGCCTTTG
Fz71021351AAGCACCAAGCAAGCAACARz71021351GAGGATGGATGCGATAAGGA
Ffj03e1213?AAGCTGTGCAGTGGTCAAGARfj03e1213?GCTGAGGTAGACACTCACACAGA
Fz5436149.7TGGCAGAGTGAACAATGCAGTGRz5436149.7GTTTTTTTTCACACCCCATTGC
Fz12261458AAGTTTGCACATTACCATCGGRz12261458GCCGAGGCAAATATTTTCAA
Fz117251451.7GCTTCCAGAAGTGGAGCAACRz117251451.7TGATTTTGATTGGGGACCAT
Fz16881463.7GCAGAGCCTCTTACCACTCCRz16881463.7TCTCTCTCGTCTGCGTCTCA
Fz113201547ACAGGGTAAGCAGGGAAGCTRz113201547GCAGAGTCCTTCTGTTTTCTCA
Fz60241585CTGCAGGCTTAATGCATTCARz60241585GGCTCAGCAGTTACATGCAA
Fz1837160GAGGCTGGCCTCTGTCGAAARz1837160TGATTAATCTTTGCCCAGCACT
Fz100361638GGCCTGAGACACCATACTTTTCRz100361638GGCTGGGAGACATGAGGA
Fz41751674GCTGATAGCCCCTTTCAAACACRz41751674GTACGGGGCACCTCCATCAG
Fz14901712TGGTGTCCATGTAAACGTGCTCRz14901712GCCAGCGCAACATCTCTGAA
Fz157151747.1AAATGCCATCTGTGCCTTTTRz157151747.1GACCAAATCCATCACCATCC
Fz14081750AATTCTGAAATTAAGATGTTGACCGRz14081750GAAAACGCACATCACGTGAC
Fz84881828TCACTCATGCGTTTACCCAARz84881828CCCCCACGGTGTATTGATTA
Fz91541858CACGGGCTCTCTAATTGGAARz91541858CCATTAGCAAGTCGTGACGA
Fz37821925AATTCTGGGGGGTAATTCTGGCRz37821925AAGGGGGCTAAACCTTCAACTG
Fz79261974GCATCTGTGCATGGGTACAGRz79261974AATCCATCGCATCTGTTTCC
Fz225321944.1GCTGGGAATAAAGGACACCARz225321944.1CAGGTGCTGTTTTCAAGCAA
Fz4329204.9CAGGTGGAACATTTCCTTTGCCRz4329204.9GCCTCCAGACAGAATGCAGC
Fz71582049TGACATTCCTAGTCCATGTTCARz71582049CCCATTTGTTGCATAATTTGG
Fz93342087CACATGGTGCTGTCGCTCRz93342087AGTCTAGAGCGCCATCTACTGG
Fz71712092.3TTCTGGACATATGGAGCCTCTTRz71712092.3ATGACCTGTACCGACCCAAA
Fz1274210AGCTGCACATCACTGAGGGRz1274210GCAGGACGAGCTCTGAAAAC
Fz11652141ATGAACGTGATCATGCGTRz11652141CACTCCACCCCTGACACC
Fz407421124CAGAGTTTATGGGGATCAGCGGRz407421124GGCCGACACAGTTACAGGCC
Fz94022223GGCCACTTTATTGGATTACAGCRz94022223TCATGAAAAGCGAAATATGACC
Fz90842256GGGACATGATGAAGCAGGTTRz90842256CAGCAAAAATCCCAGCAAAT
Fz286772259.2CCACAGCGTTCAGAGACAAARz286772259.2GTCGCCCTTCACACACTTCT
Fz8945239.4GCCCGCCTTTGTCCTATGTRz8945239.4ACAGTCTTGCCGAGGAAGAC
Fz31572348GAAGGGGTCCTGGATTTGTTCARz31572348GACACAAGTCATTGGGCAGGG
Ffc96f0323?GACCATGTTAGGCATTAAAGTTGRfc96f0323?GAGGATTTAGCTGCCTTGTTT
Fz54132415TTGATGATCCCACAATGCGGRz54132415GGGATGTTTGCCAGCTGCTT
Fz56572465GCCATCATGGAGTCCAACCCRz56572465TCCTCGTAAACCACCAAAACCA
Fz208322528.2ACGAGAGCTGGAGGATGAAARz208322528.2GAATGCTAGGATATGGTGCGA
Fz35282544GCCAGAGGCTGATTGATAAACCRz35282544ATGTGGCGCTAAGCACTTTTCC
Fz5508120TAGCGTGCCATGCGTTTTTGRz5508120GATGTTCCTGCCTTATCGGCC
Fz11464154CGAGCATGAGGACAAAAGTGRz11464154TCCATGTGCTGTGACCAAGT
fc27h08125?ACGAACGAACAAACGAACGfc27h08125?CCTTATTTCTTTTTCTGTTTTTGC
Fz85120ACAGTCTTTACTCCGCAATAATCCRz85120ACTGAAGAGGAGGACCAGAGC
Fz1406249CGCCCGTTGAGGATACAGRz1406249CACAGTTCACAAAGCGCACT
Fz20550281CGGTGTCACTGGGAGTTTTTRz20550281GCGTAAACACAGTCAGCGAG
Fz8208334CTTGCTGGAGTCAGAGTCACCRz8208334TCAGAACTTGGCCTTGGC
Fz3725364ACTAAATCGCACTTCAGCAGCGRz3725364GGTGTCCTCACATCAGCTGCA
Fz11913100TCAGAACTCCAGCCACCAGRz11913100TGGATATACTTTATCCCTAACTGAACG
Fz10164425ATTAAAACCCACACACGCAARz10164425GTCCCGCTCATTGTTTGTTT
Fz5112457CAGCGACGCTTCAGTGCTGTRz5112457CCGGGAGAGTGAGATGCTGG
Fz25562484.1AGACAAGATCAGGGCTCTGGRz25562484.1TATATGATGAGTGCTGCGGG
Fz6727530TGGCCACATTTATCTCGTAGGRz6727530ATGTGACCACTGAGTGGGAA
Fz6614540.9CGCTAAATACTTTCCAAATGCARz6614540.9GGAAGTTTGTGTGAATTGCG
Fz14143574TAGCACCCTCAGGCAGAGTTRz14143574AGACATTTCCCTCACACGCT
Fz344505105.9CACCGTTTCCTGTCAACCTTRz344505105.9AGCGCGGCAGAATATTACAG
Fz13275612CATGCTGTCCCAACACAAACRz13275612CACCTGTGGATGTTCAGGTG
Fz10183651CCGACATGGACAGACAATTGRz10183651TGTGTCCTGTTGGGGATACA
Fz1680689AACGCATTTCCTGCCTCGTCRz1680689CAGCTCTGGAGATCTGAGGGTT
Fz4706735AGCTGGAAAGCCAGATGCTCARz4706735CCCCATCAACAAAGCTCTTGC
Fz13137?TGGGTTTACAGCAGTTTGACGGRz13137?GGTCCACCGCAACATCCTGT
Fz1239769AGGAAAGGCCCTGCCTTATGRz1239769TGGGCTGTACTCATTTATGTTG
Ffj30f10798.3?TCGCATAATCATCGTTGTCARfj30f10798.3?TTAAGTAACACATTCCACCCCTA
Fz7819825TTTTCATCTGCTCCCCAGTTRz7819825TTCACATGGACAACAGTGCA
Fz789861CTCCTGCTGGCCCAGTAATRz789861ACTGAACATTCAGGCTTAAATGC
Ffk30a11867.7?CAGGAGAGCCAATAGTTTAGCCRfk30a11867.7?TCCTAGATAAGCAGGATTTGCAG
Fz562912TGTACTTCTCTCTCAATACACCGGRz562912AGGCCTCTGATTAACTGAATTACA
Fz1805948AGTAAAAATGGGGTGCGGCCRz1805948CTAAGGGCCGTGCCAGAGGC
Fz4577987TGTGTGCACCTGACAGCAGGRz4577987GTAAAGAGCCTGCCTACCCACC
Fz9199105.1GAGCCGCTTACATCTGAAGCRz9199105.1CTGCACGTCCACTCAGCTT
Fz11451055GGGAACGACCCTTTTCAATTRz11451055TCCAAGTTGGCATAGATGTATCT
Fz97011087CACTGATGCTCTCACCTCCARz97011087ATGCTTGTGTGGGTGTCTCA
Fz136661122TGTATCGCAACATTACCCGARz136661122CTGTGGGGCAATCCATAAAT
Fz69091149ATCAATGCCAACTATGTGGATGRz69091149TGGGTTTATTATAGCCCTGTGG
Fz220381136.9AGCAAGTGTTTTGTGCCATTRz220381136.9CTGCGATATGGAACATCCCT
Fz219111220ACCGAGACAGGGAGGATTTTRz219111220CTCCTCAGTTTTGTCCCAGC
Fz14001268CCGCTGTACGCCTTACATGRz14001268AACCTGTAGAGTCCTCAGCCC
Fz5643130AGTGGAGTTGACCAGCTGCTTGRz5643130CCCCAGAATTAAAACTTCGCCA
Fz16271335GCACATTTGTGTGGTGCTGTTRz16271335CCACCCGATATATTTGCCAAC
Fz60071376AGCCCTAAACAAACCGGCRz60071376GAGCATGATCTGCTCGTTAGG
Fz42031436AAGGCTGTTGTCCTCGATTGGRz42031436TCCAGCGCACTGCTATGAGG
Fz39841483TGCTCATGCTTGAACTCTGCGRz39841483TCCACAAAAACCACATGATGGA
Fz6312152.3TCCTCCTGTGTGTGAACATCARz6312152.3CAGCCATCAGAGAACATCGA
Fz138221566CAAACTGCTACACTCGAGCGRz138221566GCGGAGCTGAGTGACATACA
Fz33581555.4ATTCAATGCCTTCATCTCGCRz33581555.4CAAAAATCCCCCTTTGTGTG
Fz63651619CAGACAAACATTGGCACAGGRz63651619CGTGTGCTTACACTGTCTGACT
Fz46701655AGCGCTGCATACCAATGCACRz46701655TGGTGGGTAGAAAATGCAGCA
Fz154531667.2CACGATCACCAGCGATCTAARz154531667.2GCGTCTAGCAATATCGCTCC
Fz1990170GGGGCTAATCTCAGGCTAAACCRz1990170TGCACCATCAGAGGCTGCGA
Fz226741727AAAGTCTTTAGGCCTTTTACAATGARz226741727CGTTCCCAGATGCTTTCAAT
Fz34911776CACCGGCCAGATCATTTCCTRz34911776ACTCGCTGTCTGATTCACCGG
Fz31231782.3CCTATGGGGAGTCCTGTGAACCRz31231782.3CTTCTGGCCTGTGCGGATTC
Fz1136180TCATGTGAAGCCTGCAGTTCRz1136180AGCTTCAGCTGTTTAAAGGTGC
Fz35581851GTTATTGGCACCAGCCAGGCRz35581851TGATAGTCCTGTCGCCGCAA
Fz160192.4CGCTACCTGAAGGACACCATRz160192.4CTGCTATTGCTATACTTGTGGGG
Fz114031952TTTGTTTTAAGCATTGCCGARz114031952GCATTTTGACTCCACTGGGT
Fz220412031CAAACACCGAAATACATGCARz220412031GCGGAAGACGGTTATTGAAA
Fz118412068TTCTGTCACCTGCAGTTTGCRz118412068GGCACGTAAAAGCGGTTTAA
Fz680420110ATGTGGGAATACCTGGACCARz680420110TCTGATGGCTCTCGGTTTCT
Fz44922118ACCTGAGTGGTGGCAGAAGACCRz44922118TGGTGCAATGTTGACTGAATGA
Fz44252145ACACGACAGGAGGGGGAGGARz44252145CCCAAATGGCTGTGCTACAGG
Fz1148220GGCTACACCTCAAACGCTTCRz1148220CAACACCTGATCAAACGCC
Fz103212235CTCTCCGGTCTCCACAAGAGRz103212235TGCGACGTCCTTCTACAATG
Fz46822269AAGCCTGGCATTGTTCAGTCTCRz46822269TGCCCGTCAGGAAGTCTTTAGG
Fz154222333TGAAAGTGGACATATCCAGCCRz154222333CGCTGTCCTTCTTTCCACTC
Fz1762360CTCCAGAACAGGTTAGACACACCRz1762360CTGAACACCTCGAACCTTTACC
Fz33992443CTCCTAGGGTGCTCCGCCTTRz33992443ACAGCAGATGCCCTTCCAGC
Fz1572476CACCACCTCATTAAAGCCGTRz1572476AAGGAGGACGGAGCCAAC
Fz132322524GCTGCGTGATATTCATGGGRz132322524CTGTATCCTGCTATACAGCCCC
Fz14622564TGGGCTGTTGGGTCGTTTTCRz14622564GACGTTCTGCTCCGACAGCA
Fz14312571.7TTGATGAAGAGTGTGACGGCRz14312571.7ATCTTTGAGGTGGTGAACGG