Results retrieved:


Marker 'zk3j22.t7' ----- Marker No.: 50100
is located at LINE: 157, LINKAGE GROUP 18
Its scores are:
0001101000001000000000010000010000000000000000000000100100000100110000001000011000000000000100

Primer Forward: CAACATGCTCCAGGTTTGTG

Primer Reverse: TTCGCTGTCCTGAAACACAC

Sequence :

1 GGCATGCAAGCTTCTGGGAGTGCTGAGGGTCCGAACTCCACTGATCCACCATCAGCGCCA
61 GCTCTTTTAGGGTCTGACATGCTGTAACAACACGTACAGTACAGACAGATGTGCTGTTAA
121 CACAACACAACAACAGCAACATGCTCCAGGTTTGTGTTGAATAAACAAAATGACAGGTTT
181 AAATCATATAAACTCACTCAAATGTGCGTCAATTAAAGTTGTTCTGGGTATTTGCTAACT
241 TCAGCCGCTCATAGCCATCTGTGTGTGTGTTTCAGGACAGCGAAAACTGCAGAAAAACAA
301 TTCTCGGCTGCTTCATGTCATGGCACTGCACGACGTCACCAGGAAGAGCATTTAACTTAG
361 GTTTTTCAAAATAAGAGCCCCCTTTTTTGAAAACAGCACTCAGGTGTCTAATTTCTANNN
421 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
481 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGCATAG
541 CGCAAGTTATTTGTTTGGAACCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
601 NNNNNNNNNN

For more information, please visit the following web sites:

no more information available yet.