Results retrieved:


Marker 'zk230g20t7' ----- Marker No.: 35889
is located at LINE: 139, LINKAGE GROUP 3
Its scores are:
2100000000000000000000000000000000010000000000100000000000000100000111100110100101101000001000

Primer Forward: CAG TAA CCT TTT CAG CCC TAA TGA

Primer Reverse: TAG TTT CCA GCA TTA GGT ACG TTG

Sequence :

1 GGGATTCTACTCGGTACCCGGGGATCCTCTAGAGTCTACCTGCAGGCATGCAAGCTTGCA
61 GTTTGTCATTTCCGCCCAAATGGATCAACGATTTTTTTCATCGAATCTTCCAACCAATAA
121 AATGCTCTCTAGTATCTGACATAGGCCGCCCCCTGTGATAAAACAAAATACTATTGTTTT
181 TTTTAAAAGGGGAAGAGCTACTCTATATACCGCCCTGTCTTCATATTTCAGTTAAGATAA
241 CATCAACCATCCAATGAAAATGCATATTCCAAAGCAGTCCATGGGACCTTTAAGCATTTT
301 TAAAGTACCCCAAAGTATACTAAACCTGAGCAATCTAACAAAAAGAATTACTAATTACAT
361 TGTAAAGCATGTATTTTGTAATCTGTAGTAAAATACTGTACATATCAACAGTAACCTTTT
421 CAGCCCTAATGATATGAAGCACTGTGCATTAAACTGTTGTAAATAACAATGATGGTCTTT
481 ACCCATCATTTTTGCTCTTACAGTCACATACTGTAATTTATACGTCTACATCTCATCATC
541 CTGATGGCTAGTTCCTACAACTGGGTACCTACAGTATAGTATATCTCCCTTCATTAAAAG
601 CCCCTTTCTTATCCTGTCCTATGCAACGTACCTAATGCTGGAAACTAGAAATCCACACCT
661 CTATCTACAAAATAACTACAACCTTAATCAGTAATAATAATACACTTGCAGAAATTAGAA
721 TTGAAATTACACACAGTACTGAGGTTTATGTAATGATAAAATTGTCAACATCAGAACATC
781 AGAATCAGAATACGACAAGACAACAATCATGAGTGGGTAAGAATAAAAAAGCTTTCACCT
841 TATTTCCTCAGTCAAAGTGAACAGNTGATTGGATGAGGGTTGAAATGAACAGAATGTTAA
901 TTTC

For more information, please visit the following web sites:

no more information available yet.