Results retrieved:


Marker 'zk16l17.sp6' ----- Marker No.: 32343
is located at LINE: 173, LINKAGE GROUP 18
Its scores are:
0000101000001000000001002010000000100000000000010100100100000101111000001000011001000000000100

Primer Forward: ATTTGTATGGGTGCTTTGCC

Primer Reverse: TCTCCACGTTTTCCACAATG

Sequence :

1 GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
61 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCATTGCTAAAGAAATGTTTGTCAACAGA
121 ATATTCTACAGTTTAGATTTTTCTTTTTGTTTAATACTTTTGAAATGCTGGAAGCTTATG
181 AAAAGGTGTATTGTTTCATCATCTTTCTAAAGCAGCAGGGTACAATTTTCAACAGTTTAA
241 CATAAGAAAAAAAAAAAAACGTCTGTTTACACAGGCAGGAATTTGTATGGGTGCTTTGCC
301 AAAAAAGTGTTCAGGTTTTCACTAAAGGACTGCCAGCTCTCTGTACTTTTCTATCATTAC
361 TGAACTCTTGAAGCATGTGATCTGACACGTTTTTTTATTTTTTTTTATTTTGTAGTCAAA
421 GATTTTTTATTCACCAAAGTTGCATGAACACACATGTGGTTGCAATGCATTGTGGAAAAC
481 GTGGAGAGATTTGCAGAATGTTTATCAGTTAATGTAATGTTTTAANNNNNNNNNNNNNNN
541 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
601 NNNNNNNNNNNNNNNNNNTATCTAATGCTCATTTACATTCTTTTTT

For more information, please visit the following web sites:

no more information available yet.