Results retrieved:


Marker 'zk11f18.t7' ----- Marker No.: 52764
is located at LINE: 342, LINKAGE GROUP 3
Its scores are:
0000000101000000000000000000001011001110000001100000000100000100100010000100100001000000000000

Primer Forward: ACCGACCAAGCTTTTTAGCA

Primer Reverse: TGCGAAGTTCTTTCACACCA

Sequence :

1 CAAGCTTTTTACCTACGGTTAAACAGGACATTAAACAGGAAGTAAAGCTTAAAGTATTTA
61 ATGATTCTGGAATAAAAAAAATAAATCGAATTTTGCAAATAAATCGAACTTCTTTAATTA
121 AAAACAAATAAAACACTGTCTCTTCATTCCTCAAATATTGTTACGTTATATCTAATTAAA
181 CCGACCAAGCTTTTTAGCATTTGAATATAAAAGGCCAGTGCTCTCATTGAGTTTGCTGAT
241 TGTGACTCAGATTATCCAATGTAATTTAATGGTGTGAAAGAACTTCGCATAGATTTTAAA
301 TGATACTGGTTTCATGTATTGATTGTACAAATGAGTAGAAAAATGACTTCTTCATTGCAT
361 GTATCCTTAGGGATGAACTTGACAATTTGTGAGTCGTAAATCATAAAAAAGTTAATTTCC
421 AACCATAATGAATCAATATCACTTCTAACAGGAGTGTGTTATGGTGTATGTATATATATC
481 GCCACAAC

For more information, please visit the following web sites:

no more information available yet.