Results retrieved:


Marker 'zk11a2.sp6' ----- Marker No.: 54494
is located at LINE: 370, LINKAGE GROUP 3
Its scores are:
0100000001000000000000000000010000010000000000100000000100000000100001011000000101000100000000

Primer Forward: TTTGTCGATTTGCACTGCTC

Primer Reverse: CGGCTGTTGTGACTTGTGTT

Sequence :

1 TTTGCTTGTTTGTCGATTTGCACTGCTCGTTGAGTGAAAAGATGATTGTAGTTGATTAAG
61 GTGATTTAATTGTTTTTGCGATTCATTTCCAAGCATCCCAACACAAGTCACAACAGCCGG
121 GGCTGGACTTCTCAAAAAGAACAATGGATTCAAACCTATAACTAAGTTTCTGAGACTCTA
181 TTGGACAAATTTGATGACAATGGTATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
241 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
301 NNNNNNNNNNNNNNNNNNNNNNNNNATGGTTTGCGGCTGGANNNNNNNNNNNNNNNNNNN
361 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
421 NNNNNNNNNNNNNNNNNNNNNNNNNNCCAATCACAAGAAATGGATAAGTTATATAGTTAT

For more information, please visit the following web sites:

no more information available yet.