Results retrieved:


Marker 'zfromk' ----- Marker No.: 35563
is located at LINE: 268, LINKAGE GROUP 18
Its scores are:
0010001000001111000000000000010000000000000100000001110002000001111000000001000000001000001100

Primer Forward: GTTGGCAAGAAACAATGGCGACCT

Primer Reverse: GTTGTCCTCAGAAGCTTCCCGTAA

No Sequence available yet.

For more information, please visit the following web sites:

MGH zebrafish search