Results retrieved:


Marker 'zc128e1.ya' ----- Marker No.: 33147
is located at LINE: 89, LINKAGE GROUP 3
Its scores are:
0000000000110000000000000000000000000000000000010000000100000000000110000100100101110000000001

Primer Forward: TGATCACACTAGTGCCCAGC

Primer Reverse: TAGCCATCATCATTCCACCA

Sequence :

1 TGGGGAAATAAGCTTTCTGGNTGNGGTCCACTCTGCCGTCACTCTCCTTGATGAAGCGCT
61 GCTGCTCTCCAAACGCTCTGATCACACTAGTGCCCAGCAGCGTCTCATTGAAGTGTGTGT
121 AGACTGGAGAGCGGCTCACAGACTCCAGTCGCTTCATTTGACGAGAGGACGCCACATAGA
181 AACGCTAGAGACAAACAGAGAGCCAGGAAATGACTAAACTTCGAATGAATTTCTAAATGT
241 CATACTGCAATAACACTGTGTAACAAGAGGTTAAAAAACTGACTGACCTGTACAAAGAAG
301 TACACTCAGGCCCAATGGTGGAATGATGATGGCTACCAATGGAGTGGCGATGAGGATGAC
361 TGCACATGAGCCCCAAACATTGAACATGGAGCCCATGAACATTTTTATGATGCTAGGTAT
421 GACTGAGTCGATCGTGTC

For more information, please visit the following web sites:

no more information available yet.