Results retrieved:


Marker 'z9408' ----- Marker No.: 2723
is located at LINE: 3, LINKAGE GROUP 3
Its scores are:
0001000000000010000001000000000000010000000000000000000000000100100010000110100100000000000000

Primer Forward: CTCCAGCTCCTCCATCTCAC

Primer Reverse: TGCCACTGTCACATTTGGAT

Sequence :

1 GGGCTGCTCATCACCTCATTCTTCTCATGATGGCAGATCCCCGTCAGCCAGAGAGCCTCC
61 AGCTCCTCCATCTCACCTACAGCACACACACACACACACACACACACAGTGAGCATGATG
121 GGATGCAGCGCTCCTTTATAAACTGCAGATTGGCTGTATTTGTGAGCTCAACACTGCTGG
181 TAGACACAATACAGCCATAATCTCAATCCAAATGTGACAGTGGCAGTGACCTGTGACATG
241 AGCCTGAGCACACACTGCTCTCCTGCCTGACCTCTGCAGTATTCTCCTGGAAACATCACG
301 GCTCTCTTCTCCTCATCTGTGTGATCTGCTCTGACACAGTCTCCATGGTAAAGGCGCTGT
361 AGGACTGAGGATGACTTGTGTTTGTGTGC

For more information, please visit the following web sites:

MGH zebrafish search