Results retrieved:


Marker 'z58719' ----- Marker No.: 16897
is located at LINE: 168, LINKAGE GROUP 3
Its scores are:
0100000000100100001110000000010000000000000001110000000100000100010111000110100101101000000000

Primer Forward: CATGGGCAGTTTAGTTCATCAA

Primer Reverse: AGATTTACTTTGCAAGTGCACA

Sequence :

1 NGATATTCAAGCTCGCGTACCCCGGGGATCTCCTAGTACGGCCGCCAGTGTGCTGGAAAG
61 ACTGAGAAACACCCATACACTCATTTACACACACACACACACACACACACACACCATGGG
121 CAGTTTAGTTCATCAATTGAGGAAACTCCACATGAACACGGGGAGAACATGCAAACTCCA
181 CACAGATATGTCAACTGGACCAGCTGAGACTCGAACCAGCGACTTTCTTGCTAGGCAACA
241 GTGCTAAACAATGAGCCACCATGCCACCTACTTCAATTTAAATGATTATTTTTACAGTTT
301 AGGATAGGTCAATAATCAGAAAGGACATCATTCTGATACATTATCATTTAATGCAGTATA
361 ACAAAAAACTAACACACACACACACATGTGCACTTGCAAAGTAAATCTAAACAACTGACT
421 CTGATATCCGTCTTTCCAGCACACTGGCGGGCGCTCGAGCATGCATCTAGAGTCGACCTG
481 CAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCC
541 GCTCACAATTCCACACAACATACGAGCCGGGAAGCATAAAGTGTAAAGCCTGGGGTGCCT
601 AATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGGCCGCTTTCCAGTCGGGAA
661 CCTGTCGTGCAAGCTGGATAAATGATTCGGCCAACGCGCCGGGGAGAGGCGGTTTGGGTA
721 TTGGGCGCCAGGGTGGTTTTCCTTTCACCAGTGAGAAGGGCAAACAGTGATTGCCTTCAA
781 CGCTTGGGCCTTGAAGAGTTGACGAAACGGTCCCACTGGTTTGGCCCAACAGGAAAAATC
841 CCGTTTGATGGTGGGTCCCGAAACGGGAAAACTCCCTTTTATATTAAAAAATAACCGCGG
901 AA

For more information, please visit the following web sites:

MGH zebrafish search