Results retrieved:


Marker 'z35724-a2541d04' ----- Marker No.: 32509
is located at LINE: 338, LINKAGE GROUP 3
Its scores are:
0100000101000000000000000000000000000000000000110000100100000000100010011110101001000100000100

Primer Forward: AGCGCTTGTGTTTGATGCAAC

Primer Reverse: GGCGATCGTGCTACCCAC

No Sequence available yet.

For more information, please visit the following web sites:

no more information available yet.