Results retrieved:


Marker 'z27145f' ----- Marker No.: 36667
is located at LINE: 151, LINKAGE GROUP 18
Its scores are:
0001101000001010000000010000010000100000000000000000100100000100110000001000011000011000000100

Primer Forward: CAGAGTTGCTGTGGTTACAGTTG

Primer Reverse: AATGAGCAGAAGCCCAGAAA

Sequence :

GCCATTAGAGTGANAAANAGAGTACTGGATACTGGATAGTGTCTCTGACTCCANCAGAGTTGCTGTGGTTACAGTTGAATACTCAGACAGTGTAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNNGTGTGTGCGTGTGTGAGAGGATTTTTGAGAGAGAAGTTTCTGGGCTTCTGCTCATTAGTCCTGATAAGTGTAGGTTGGATTGATAAGAATTAACAAGGGATGGCAAGAAGGAATTTACAGCGGATGGATATCCCTTCCCAACTGACTAGATTCCAGGGTCATTTCCGATTACGGTTCTGTAGTGTAATTCAAGATTGAAAAGATTTACAAATGAATCCATTCACAACAAGCCACAGAAAATG

For more information, please visit the following web sites:

no more information available yet.