Results retrieved:


Marker 'z10691' ----- Marker No.: 2930
is located at LINE: 250, LINKAGE GROUP 18
Its scores are:
0110101000001010000000010000010000000000000100010001110000000001101000001000000101000000000000

Primer Forward: GTGAGGGGTTCAAACCTCAA

Primer Reverse: TCAATGGCTCAGACCCCTAC

Sequence :

1 GGGCGGGTGGTGGTGGAAACCGACGAACAGCTAATGTAAAAGCGCATGGTTTCGCTAACC
61 TCTTCATCTTGGACAAGAAGGACCTGGCAGAGATCTTAGTGCACTATCCCGAATCCCAGA
121 AACTGCTGCGCAAGAAGGCCAAGTGAGGGGTTCAAACCTCAAACCAAAGCTCAAACCTCA
181 ACCAAAAGCACCAGCAAACCTCTCTCTCACACACACACACACACACACACACAACATCCA
241 GCGTAGGGGTCTGAGCCATTGACAGCTCTGTATCACACTCACAGATCTCCTAGTGC

For more information, please visit the following web sites:

MGH zebrafish search