Results retrieved:


Marker 'lmo2' ----- Marker No.: 4215
is located at LINE: 207, LINKAGE GROUP 18
Its scores are:
0010000000001110000000000000010000000000000100000001110000000101001100101000000101001000000001

Primer Forward: CCACAAACAAGACGGAGCCTA

Primer Reverse: CGCACAAACGCTTCAGAGAT

Sequence :

1 GAATTCGGCACGAGCAGCAGCCTTGCGGGACACTGGCGTGGGGACTTGCAGCGCAAAATG
61 CACCACAAACAAGACGGAGCTTAAACGCCACATTTATCACGCGCCGGAGAAATTGAACAA
121 CGCCACTGTCTGTCACTTCACATTATTCAGACAGAACATAGGACTGAATGCGTGGTGACA
181 GAAATCTAATGTAAATGAAGGATGCTTGGAATCTGGCGTACACAATGTGTGCTGGATGTT
241 TCTGACCTTTGATACACTTGCTAAGACAGCAGAACAGGTGCATCTCTGAAGCGTTTTGTG
301 CGGCAGATGGTCTTTCGGAACCGCAGAGGGCGAGTTACGGGCCATATTTGGCTTAAAAGG
361 CGCGCATACCAAATGCGCTGAATTATACCTGAATCATATTGAAAATGGCTTCTACAATTG
421 AACGGAAAACACTGGAGGCAAATGAGGAGCCGGTGGATGAGGTGCTCCAGATGCCGCCGT
481 CACTGCTGACCTGTGGCGGGTGTCAGCAGAGCATCGGAGACCGCTTCTTTCTGAAGGCCA
541 TCGAGCAGTACTGGCACGAGGACTGTCTGAGCTGTGACCTCTGCGGCTGCCGCTTAGGGG
601 AGGTGGGACGCAGGCTTTACTACAAACTCGGCAGAAAGCTGTGCAGGAGAGATTACCTCA
661 GACTGTTTGGTCAGGACGGACTCTGTGCTTCCTGTGAAAAGAGGATCCGGGCCTTTGAAA
721 TGACCATGCGTGTGCGTGACAAAGTCTATCACCTCGAATGCTTCAAATGTGCTGCCTGTC
781 AGAAACACTTCTGTGTTGGAGATCGTTACCTGCTCATCAACTCGGACATTGTGTGTGAGC
841 AGGACATTTTTGAGTGGACCAAACTCAACGGCAGCATAGTATAGTTTTCTGCCGAAATCA
901 TAAACAAAATGTAACCTGTCAGCATTTTCAACAAACCCTTTACTAATAGAAACATCAATA
961 ACAAAATATATATTTTAAAGAAATGAGCTTTCTGGCTCTATTAGCTGTGCTCTAAATGCT
1021 TGTCGCTTTTTGTTATTTAAACTTGAGAAAAATGCCACCAGGTTTCCCAGTGTTGGGTTG
1081 CAGCTGGAAGGGCATCCACTGCGTAAAACATATGCTGGATAAGTTGGCGGTTCACCCCCG
1141 CTGTGGCGGCCCCTGATTTTTAAAGGGACTAAGCCGAAAAGAAAATGAATAAATGAATGA
1201 TAATTGCCACCAGCAACATGAAGCCTTTTTTAAATTTGATGTATTTTTGCAGAACAGCGT
1261 TATACAATTTTTAATGTATTGCAATAAAAACTGATTCCCTTTGCTACTTTTACACAATTA
1321 CTTCGATTTGAACTATAGTTCTATTTGTTTTGAAGTAACACAATTGCAATAAATGTACAG
1381 ACATCTTAGAAAGATGATGCTTATTTTCTCAAGCTGCATTTTGTTCACTGGACAACTGTT
1441 TTCTGTCAATTTTTAAAAATGTATTTTATTTTTGTGATGCAAGGCTGCATTTTCAGCAGT
1501 CTTCAATCCCATCTTCAGTGTCATATTAGCTTTAATTGGAGCTCAAGAAACATTTTTTCA
1561 CATTATTTTTTATTGTGTGATGCTTTTTTGTGATGTGATATCTATAATATGTTATCAAAG
1621 TGCCAACAGAGCACACCCAATATTCCTAAAAGGACATATTGTATACATTTCATATATATT
1681 GTGTACATATTGTATGCCAAAAAAAAAAAAAAAAAAAAAACTCGAG

For more information, please visit the following web sites:

NCBI nucleotide database.