Results retrieved:


Marker 'fl59g06.y1' ----- Marker No.: 6733
is located at LINE: 98, LINKAGE GROUP 3
Its scores are:
0100000010110110001110000000010000000200000000110000000100000100010111000110100100000000000000

Primer Forward: TTCCTGCAGGAGAACAACGTC

Primer Reverse: GCAGTGGTGGCCGTCTG

Sequence :

1 CACCGTAGCTCGCGTGTTTGCAGTGTCAGAAAAGTTGTAAAAGCTCCTTTTACGATAGCA
61 TATCGTCTCTAAAACGTTTGTTTTTGTAGTCAATAACGTGTTGACTGCGCTTGTTTCCGT
121 GGAGGACGATTTATCTGAAACCTTGAGCGACACATTAAGGGGTCAACATGGCCCAGTGGA
181 ATCAGTTGCAGCAGTTGGAGACGCGGTATCTGGAGCAGCTGTATCACCTGTACAGCGACA
241 GCTTCCCCATGGAGCTCCGACAGTTCTTGGCCCCCTGGATAGAGAGCCAGGACTGGGCGT
301 ATGCGGCCAACAAGGAGTCTCACGCCACGCTGGTCTTCCACAACCTGCTGGGCGAGATCG
361 ATCAGCAGTACAGCCGCTTCCTGCAGGAGAACAACGTCCTGTACCAGCACAACCTGCGGC
421 GCATCAAGCAGCACCTGCAGAGCAAGTATCTGGAGAAGCCCATGGAGATCGCCCGCATCG
481 TGGCCCGCTGCCTGTGGGAAGAGCAGCGTCTACTGCAGACGGCCACCACTGCACAGCAGG
541 ATGGCCAGGTTGCCCATCCCACTGGCACTGTGGTGACAGAAAAACAGCAGATACTGGAAC
601 ANCACCTGCAAGACATCAGGAAGAGAGTACAGGACATGGAGCCGAAGATGAAGATGTGGA
661 GAAATCTC

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.