Results retrieved:


Marker 'fk52a05.x1' ----- Marker No.: 11918
is located at LINE: 254, LINKAGE GROUP 18
Its scores are:
0110001000001010000000010000010000000000000100010001110000000101101000001000000100000000000000

Primer Forward: CACCTGTAACCAAGAAGCC

Primer Reverse: TATGTGACTTTCACTATGCACC

Sequence :

1 TTGGAAGTAGTGAATTTATTGATGTGTTTCCCACCTGTAACCAAGAAGCCATTTTCCATT
61 GGATTCACTCATTGTTTACTTCTAATATATATGAACTTTGTATGGTTTCCCCTCACCCCA
121 TGACCATCTCACAATCAAGCAGGCAATGACAAGGTCCAAGACTGGAGCCGTTTAGGTGCA
181 TAGTGAAAGTCACATACAGAAATACTGTCACAGGAAGAGGGAAAAAAG

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.