Results retrieved:


Marker 'fj87f12.x1' ----- Marker No.: 20868
is located at LINE: 199, LINKAGE GROUP 18
Its scores are:
0011000000001010000001001111011011001110000100010000100110000101101010001010101000111100000101

Primer Forward: CGTTCTTCCTCTCGCTGTG

Primer Reverse: ACCCAGACTCATACTCCATC

Sequence :

1 TAATCCATCTGATGCGTTTTCCTTCCCAAGATTTAAAAGAGTCTGTCAGAACACAGACAG
61 TTCTTCAGGTTTTTTTTCCTTTCATGTCTTTAAGTGCATTTCTAGGCATGACCTCCATGG
121 TAAAGAAGATTGCAGGTGTGTGGATGTGTGTTTTGACTGGCGTTCTTCCTCTCGCTGTGA
181 TGCGCTATGGCTGTTGTCTTTGTGAGATGGATGCATTGGGAGGCTTTGACGTGCTCATGC
241 ATGGTTTTTTCCACAGGAGGGCGTCAGAGGGAGGAAAAACTCAATGGCCAGATCTACTGT
301 TCCTCACCATCTCTAGGATGGAGTATGAGTCTGGGTGTTGGGGGNTTGNAANGGACATTG
361 NGGGGTGG

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.