Results retrieved:


Marker 'fj85b03.x1' ----- Marker No.: 20844
is located at LINE: 144, LINKAGE GROUP 18
Its scores are:
0000101000001000000000010000010000100000000000000000100100000100110000001000011000000000001100

Primer Forward: GAATCAAGAGAAAGAGACCC

Primer Reverse: CCTTTACGACACTCACTCC

Sequence :

1 TCTGATGAGCATTTCTCAAACGCTCTCTCCAATTTGGTCCTTTGTGACCACAGAAGTGAA
61 AAACTGCAACTTCCTGTCTTTGTGGCCTGTTGGGGAACCAGTAGTACTAGAGCAGCAGAA
121 TCAAGAGAAAGAGACCCTTAAAAATGTTCAATGCAGTTTGAGAGGGAACTAGACTTANAG
181 GCGCCCGTTTCCCTCACGAGTAGAACTTGCTGTTGTTTATCTTTTGCTGTGGTTTATTTA
241 TCTTTTTTTCAGAGTAAGTGAACTGCGAGAGGTCTTCGCGGCGTTGAGGGCCACTGGAGC
301 GCAAGTTGGAGTGAGTGTCGTAAAGGCAGAACTCGCTGCTCATCTCCGCCTGCTTCTTTT
361 GCAACTGTTTCGAGGAGGAGTAAAGTTCCTCCTGTGCTTTCTAAA

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.