Results retrieved:


Marker 'fj81h12.x1' ----- Marker No.: 22362
is located at LINE: 424, LINKAGE GROUP 3
Its scores are:
1100000000001000000000000000000000000000000100000001011100000100000000000000001001000000000000

Primer Forward: CAGATGTGTGGAGTCACGC

Primer Reverse: TGGATTCAGTGTTGTGTTCGGG

Sequence :

1 CAGTAAATTTTGCTCCTGAAGAGCCGAGAGGATGAGGGTTGCTTCCCTCAGATTTGCATC
61 ACAGATGTGTGGAGTCACGCGCCGGCGAAATCTGCAGAGTCTGCATAAAATGCTGCTTTA
121 TTCCCGCAGCTCAAGGCTTTTAGGACTGGCACCCGTCCCAGTTTCATCCACTCTGCATCT
181 GGTTCATTTAGGACAGGGACTGCGGAAGGGCACAAGAAGTACTCCATCTCCACAGGCTTA
241 TTACATCAAGACCAGCATTCATCATGCTTTCCCGAACACAACACTGAATCCACCCAGAAA
301 CAATGAGATTATGTGGAAAAATATTACGTTTGGTTATTATTTACTCACTCGGGATGCGAC
361 TGCATGTGAGTTTTGGGGGAGGGCAGAGTCATTGATGAATGTTAAAGGTGCCACATTGTA
421 AAAATCTATAGGCATAGT

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.