Results retrieved:


Marker 'fj78g11.x1' ----- Marker No.: 20774
is located at LINE: 26, LINKAGE GROUP 18
Its scores are:
0001000100001000000000001001000000100000100000000000001110000100000000000000000111000200000100

Primer Forward: TTCCATTAGAGAGCCAGCC

Primer Reverse: GATCACCATTATCATCACGCAC

Sequence :

1 TGATGCTAGAAAATCTGATGTTTATTAAAAAAAGCATAGCATTGTCTTTCAAACTTGCTA
61 AAAGGATACAGAATAAATGCTAAATATTACAAATTTGCTGTTTCCTTGTTTTTTCTCTTC
121 TTTAGCACAATGTTAAATGTCTGATAGTTTATCAAAGCATATAATTGATTCGCAATACTG
181 ATTTCCATTAGAGAGCCAGCCATCATGTGACTCGATTTTCCCTTTATAGTGTGAAATAAT
241 CAGAGACAGTTGTTTTTAGTCTGATATGCTGCTGCAGAAATGTGTGTGCGTGATGATAAT
301 GGTGATCTTCAGAGTTTCTGGCTGCTGATTGGACTGAAGGGTTTGGACGTTTCCTCCGCC
361 ATGAAGGCCTCGATTTCTTCCACGGTTCGAGGAACGCAGGTCAGCAGCTCCACACCGTCA
421 GCCGTCACCGCGATATCATCCTCAATGCGTACCCCGCCGAAGCCTCGGAAGCGCGTCAGC
481 ACTGCAGTGTTGATGAAGCCGCACTGAGCAGGAGATGCGAGCGCTTTATCCAGCAGGTGA
541 TTGATGAATAGATTCCCGGCTCCACCGTCAGGACCATCCTCTTCTGCAC

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.