Results retrieved:


Marker 'fj56a12.x1' ----- Marker No.: 20624
is located at LINE: 120, LINKAGE GROUP 18
Its scores are:
0000101000001000000001000010000000100000000001010000100100000101111000001000011101100010000100

Primer Forward: ATCATCAAGAGTGAGGAGG

Primer Reverse: TCACTATTTCAGAAACACGG

Sequence :

1 TTTTTTTTTTTTTTTTTTCCGTGTTTATGAACACCTTGATTTTATTAGAAGTTCTGAGTC
61 AACATGGTTTTCTGGAAAGCCACTTACACAAACATAGAAATGCATCATTTTGTAGATGAA
121 GTATGATTTAGAGAATTTACTGCAATGCTATCTTCCAGCCTGCCCATGCACAAAATGAGC
181 ATCACAGATCTGAACAGAATCATCAAGAGTGAGGAGGTCCAGAAGGCCATTCGTCCTGCA
241 AAGTAAGTTCTGGTTTTGACTGTTTATATTTGCCTGTCGTTGCAATGATGAGATTCTTAC
301 TTCAGGTCCGTGTTTCTGAAATAGTGATTGTATTGGAAGTTCTGAGCCATCTTTCCTTTA
361 ATAGTCCTAGCCTTCAGTCTATAGTATTACTAACAAGTGTCTTTTTGACCTTGCAGCCGC
421 AAGATTAATCGCAG

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.