Results retrieved:


Marker 'fj43f07.x1' ----- Marker No.: 20463
is located at LINE: 120, LINKAGE GROUP 18
Its scores are:
0000101000001000000001000010000000100000000001010000100100000101111000001000011101100010000100

Primer Forward: CGGGTTTATGAACACCTTG

Primer Reverse: AGGCTGGAAGATAGCATTG

Sequence :

1 TTTTTTTTGGTTTTTTTCCGGGTTTATGAACACCTTGATTTTATTAAAAGTTCTGAGTCA
61 ACATGGTTTTCTGGAAAGCCACTTACACAAACATAGAAATGCATCATTTTGTAAATGAAG
121 TATGATTTAAAGAATTTACTGCAATGCTATCTTCCAGCCTGCCCATGCACAAAATGA

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.