Results retrieved:


Marker 'fj39e10.x1' ----- Marker No.: 22253
is located at LINE: 113, LINKAGE GROUP 3
Its scores are:
0100000010110110001111000000010000000000000000110000000100000100010110000110100100000000000000

Primer Forward: CATCTCACTGAGGCGGAAC

Primer Reverse: CAACCCTGCTTCAACGCAC

Sequence :

1 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAACACATAAACGTTTATTTTTTAATACTTA
61 ATACCACACAAAAAACACAAAGGGATGATGTACATACAAGGGGATGGGGCGGGATGTCCA
121 TCTTTGTCAAACCGACAGCCAATCAAAGGCTTCGGTTTACCTCATGCTCACTATCCCAAA
181 GGGAAGGCAGCAAATCCAGTCAGCACACATCTCACTGAGGCGGAACAATAAATAAAGGAC
241 TGCAACTGGGGTTAAAGAGGGGTTGCTTCAAAGCACAGGTGTCAAACTCAACTCCTGGAG
301 GGCCGCAGCTCTGCACAGTTCAGTCCCAACCCTAATTAAACACACCTGATCAAACTAATT
361 AAATCCTTTGGGCTTGTTTGAAACCTACAGGGAAGTGCGTTGAAGCAGGGTTGCAACTAA
421 ACTATGGCAAACTACCCCACC

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.