Results retrieved:


Marker 'fi41g07.x1' ----- Marker No.: 22016
is located at LINE: 254, LINKAGE GROUP 18
Its scores are:
0110001000001010000000010000010000000000000100010001110000000101101000001000000100000000000000

Primer Forward: GTTTGTAGGGCTCTGTTGGGTC

Primer Reverse: TGGCTGGAGTGGTAAGCTGGG

Sequence :

1 TGTATTTATTTTTAAAATGTTAAATGTAATCCCTGATTCAAATTTAAGACACTCCAGACA
61 TATTTTTCAAGTGTTTCCATGTGTAACTAAGTGACATTGCATTTCATACATACATTTAGC
121 ACAGAATTCATAAAAAGAGTGAAGACGTTCACATTAAAGTTCATGAGTGTGAATAATATA
181 CGCAAGTCCTTAAATTGAAAACTAAAGGTACAGACCCAAACAAACAAATTCATTCACAAT
241 CAAAAACATATAAAGCTTCACTTTGTTTTAGTGTGTAACCGCTAAAAAACAGGAAACCTT
301 TAAAAAGGAGATTTATTTACACACAGAGACAGATTAAAAACCCTTAAACCGAACTGCTTA
361 TAATATATACACGTTTAAAAAACATCCTTTGCATCGAAGACAAATAAAAAAAGGTTAAGA
421 AGTCCATCCCTCTGTACACCCAACCATATCACAATCTGATGCGTTTGTAGGGCTCTGTTG
481 GGTCATTTTATGTATGTTATAAAAATATTTGTCTTTAAAATCTCTCATAGTTCGTGATAA
541 TCCTAAAAGAAGTTACACTCCTGTCTTCTNCTTGATCCAGGCCCTGAATTTTGGGACGTT
601 TGAGTAGATGCCTGGCTTGTTTCTGCGAGCGCATCCGTCGGCCCAGCTTACCACTCCAGC
661 CAGAAACATACGCTTGCCAGACGGAAACGACAAAGGACCACCAGAGTCACCCTGACAGGC
721 ATTCACTTCCTCCTGAGAGAACGCCCGGCACAC

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.