Results retrieved:


Marker 'fi41b02.x1' ----- Marker No.: 22013
is located at LINE: 334, LINKAGE GROUP 3
Its scores are:
0100000000000000000000000000010000000000000000010000100100000100100010011110100101000101110000

Primer Forward: CAGTCCCACACTTTGTCCG

Primer Reverse: GGATGGAAAGAATGAGGGAG

Sequence :

1 CGGCATCAGATCATATTCTCTTTGAAGACCTGGTGTGAAAATTAATGAACCTCCGAATCA
61 AACGGGGGGCCAGTGCTCAGTCCCACACTTTGTCCGTGTGGTATTATTGATATGGAGGTT
121 TCAAAGAGTCACATACAAATGTTTGAAGTGCCATCTCCAAAGCCAGGGCGTCTTTGGGAG
181 CCGTTCAATTGGTCCTGGGAACCAGCAGAGGGATGCTGAGCAAATACTTCAAACGGACAG
241 ATGCAAGGATGGCTCCCTAACGTGTCGCTCCCTCATTCTTTCCATCCAAAAACCCTCATG
301 TTTACAAGACATTGGCTTGGTAGAAAAGTGGGACTCTTCATCACAGGGATCAACTGCAGC
361 AACGGGATGAGCTCCGGACTACAGTGAGGAAAACAAAACAAGCCCTTCCTGACACCATCT
421 CCTTTCATTCCTGGTGTGCTCAGATCCCTTTTTTAAGATCTCTTCATATATAGATATATA
481 AAAACAAATCATGAGCTGATTTACATGATTAGCATTGGTATTAAAGTTAGAAAGAGTTAA
541 ATTAGTTTCAGATTCAATAAATAGAAGGG

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.