Results retrieved:


Marker 'fi28h02.x1' ----- Marker No.: 21903
is located at LINE: 174, LINKAGE GROUP 3
Its scores are:
0100000000000000000000000000010000000000000000100000000101000100010101000000000101101000001000

Primer Forward: CTACCGATAATAACATCCCAC

Primer Reverse: TCACATCTAGCAGACCGAC

Sequence :

1 TGAGAATATGAAAGGCATAGATGATCATAAAACAATCGTGATATCAGATTATCTACCGAT
61 AATAACATCCCACTTCATTTTGGCAGACGGTTTGCTTCATACTTGAGGATTGCACAGAAT
121 AGGAACCAACTCAAACAGAAAAAAAAAAAAAAAACAACATCCTCTGACTGTGGTAACTAA
181 ACCACACACACACAAACATCAACACATGCATACATAGTAGATATATATGTTAAAAAAATA
241 AGCCAAAATATTCTGAGGTGTCGGTCTGCTAGATGTGACTTCATAAAAGACAAGTGAAGA
301 CTGGCTCCTGATTGTTGGATGATTGTAGTTGATGAAACATCGGTACCCCAGAATGCATTT
361 GTGCGCAAGGCAGTGTTTCATACATACAGCACAATGGAGACCTGAAATTCCAGCGCTCTG
421 CTCAGACGCTAAGCCTCATGGGAACCGGTGCTCGAGTCAGGAGTGCTTGCGGAAGGTGAA
481 AATGTCCCGTTTCTTGGAGCCCCGCTTGCCCTCNATGGGCTGGTTGGGGCTGGGTAAGGG
541 CGGGCTTTCNGGGGTGG

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.