Results retrieved:


Marker 'fi05f09.x1' ----- Marker No.: 21726
is located at LINE: 306, LINKAGE GROUP 18
Its scores are:
0110000000001111000001000000001011001110000100000000100000000101101000001000001110101000000001

Primer Forward: TGCTGTCTCGTACTGAGCC

Primer Reverse: CACCTCATACCTGACCTCC

Sequence :

1 AGAGTCATTGTTTAACTCATAGATTCCCCAATTCAGGAGACAACCGCTTGATTCAGATTT
61 GAAATTTAAAACAGCATTGTTGCTGACCAAGATACATCATTCAGAGACCTTCATGGCAGT
121 CCTCGTAAAACAAGATTCTTGAGGTCCATATTCAAAAGGTAGAATTGTTCTTTGCTTGCC
181 TCGAATGCAGTTTGTTTTGTGACTGGCTGATCACGCTGCGCTAGCATTCAGTCCAGGGAG
241 ATAATGTCTGATAGACCTGAAGATCCTCCAGTGATGACTCCTGTCTCATGACTCGAGCTG
301 CTGCTGTGAGTTGCTGTCTCGTACTGAGCCGACGAGGAAACCAGACTGGCGCTGGTGGTG
361 GCACTCTGAAGGCTGCTGGAGAGGCTGTCTAAAAATATGGGCCCTCTGAAATGCTGAGGA
421 TCCCCTTGAATCAGAGAAAATAAGTCAAGACTTTGCATATCTGTGGGAATAGTGGACAAG
481 GAGGAATGGTGGAATGGAACAGAGTAGTCCGCTATTGAGGAGGTCAGGTATGAGGTGTCC
541 AGCGACTGGACATTTGGCACCCGAACAGTTGATGGCTGGTAAGTCAAAACGCCTTTGCTG
601 TGCATCTCCTCAGCCTTTGACATGTATATACAGCGCTTCTTCAGAGGAGA

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.