Results retrieved:


Marker 'fd09g07' ----- Marker No.: 6705
is located at LINE: 175, LINKAGE GROUP 18
Its scores are:
0000101000001000000001000010000000100000000000010100000100000101111000001000011001000100000100

Primer Forward: ACTCAAAGCTCTAAGCGTTCC

Primer Reverse: TATTGTGGTCCCGAAGG

No Sequence available yet.

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.