Results retrieved:


Marker 'fc83a08.x1' ----- Marker No.: 9090
is located at LINE: 206, LINKAGE GROUP 18
Its scores are:
0010000000001110000000000000010000000000000100000001110000000201001000101000000101001000000001

Primer Forward: AGGTTCTTGTTGCTGGTGG

Primer Reverse: GACATTGTGTGTGAGCAGG

Sequence :

1 TTTTTTTTTTTTTTTTAAGATGTCTGTATATTTTATTGCAATTGTGTTACTTCAAAACAA
61 ATAGTACTATAGTTCAAATCGAAGTAATTGTGTAAAAGTAGCAAAGGGAATCAGTTTTTA
121 TTGCAATACATTAAAAATTGTATAACGCTGTTCTGCAAAAATATATCAAATTTAACAAAA
181 AGGTTCTTGTTGCTGGTGGCAATTATCATTCATTCATTCATTTTCTTTTCGGCTTAGTCC
241 CTTTAAAAATCAGGGGTCGCCACAGCGGGATGAACCGCCAACTTATCCAGCATATGTTTT
301 ACGCACTGGATGCCCTTCCAGCTGCAACCCAACACTGGGAAACCTGGTGGCATTTTTCTC
361 AAGTTTAAATAACAAAAAGAGACAAGCATTTAGAGCACAGCTACTAGAGCCAGAATTATA
421 TTTCTTTAAAATATATATTTTGTTATTGATGTTCTATTAGTAAAGGGTTTGTTGAAAATG
481 CTGACAGGTTACATTTTGTTTATGATTTCGGCAGAAAACTATACTATGCTNGCCGTGAGT
541 TTGTCCACTCANAAATGTCCTGCTCACACACAATGTCCGAGTTGATGAGCAGGTAACGAT
601 CTTCAAACACAGAGTGTTTCTGACAGGCAGCACATTTGAAGCCATTCGAGTGATAGACTT
661 T

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.