Results retrieved:


Marker 'fc37a08.x1' ----- Marker No.: 21301
is located at LINE: 341, LINKAGE GROUP 18
Its scores are:
0110101000001010000000010000010000000000000100010001110000000001102000001000000110000000001000

Primer Forward: ATGGCAATTTCATTAGGGTC

Primer Reverse: TGTGCTACAGTACATGCTC

Sequence :

1 TTTTTTTTTTTTTTTTTTTTGAGACAAAGTTTTTTTTTTATTAAAACTGCTGAAGGATAT
61 TTTTAAAATGACGACATCTTACAAAAATACATCATGGCAATTTCATTAGGGTCTGTGTAA
121 TTGTCTGATAAAAAGGTAGTTACAAAGCTTTGTTGTAACAAAATGATCTCCCCCCTCCCC
181 AGCAGTGAAGAACAGAGAGGTCACTAGTGCAAAGGATTGTATGGAAATGGCCCAGTGCAT
241 TGTCTGCTGATCTTACAAACAGCCTAAGCTGAGCATGTACTGTAGCACACTGGAATAACA
301 GTATTTCTAAAACGGGAAGTCTGGAAAACAAACAGCTGGATTTACCACAG

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.