Results retrieved:


Marker 'fc35e02.x1' ----- Marker No.: 15679
is located at LINE: 245, LINKAGE GROUP 18
Its scores are:
0110001000001010000000010000010000000000000100000111110000000101001000101000000100000000000010

Primer Forward: TGGTGGTTTCAGCAGGTGG

Primer Reverse: GGTGGCAGTGAACACAGAC

Sequence :

1 CTTTTTTTTTTTTTTTTTTCCAATGGGAACCACCAAGTCTTTCGATCCTCCCACCCTTAA
61 CGGTCTGTTTGAAGTCATGTCCTAGTGCCGGTGGCAGTGAACACAGACCCATGTAACAGC
121 TACACATCTCGCTTAGAAATTCTAGATTTTTGCACGTTGCCAATTTGAGCTGCACTGCAG
181 CGAGTAGCACTATTACATGATGAAAATATTAAATTATCTCTATGATTAGAGTCACCCAGG
241 CTCAGGGACCCCGCTGAGTGCTCATAAGTCAGTGTTACAAGCAAAAGGCTGGAAAGCAAT
301 TAAGCCTCATGTTTTCACAACGCGCAAATGAGGCCATTTATTTGAGCGACCCACGTCAGG
361 AAACATGTCAACACTGGAAAACGGATGAGTTAATAACTGCAAATCTGAACAATTGCACCA
421 CCTGCTGAAACCACCAGAGGATTACACTCAAAACCTTTGAACGGAGTCTCGAGTTTTAAA
481 ATAAAGAATAAAGCAAGTGTGAACTCATTTCTTACGATAACAAAACACTTGCGGTGCATT
541 ACCAGGGAAGGTTTAAACTTTAAACTTATTTCCCCATGAAGGGGGATGGAAAGGGGGAAT
601 AGCAAACAAAGTGCCATCAGTGCTGACAGATCCTGATTTTAAGACTTTCAACATCTCTCA
661 ATGTCATCCAGCTTTTACTGCTTAAACATCATTAAAAAATAATGAGATTACAATGTACAA
721 TGCCCAGACTGATAATGCCATTAGGAGATGCTACCAGATGCAAATGCCTGGATCCG

For more information, please visit the following web sites:

Wustl zebrafish search