Results retrieved:


Marker 'fc27c06.x1' ----- Marker No.: 20126
is located at LINE: 314, LINKAGE GROUP 18
Its scores are:
0010001000001111000000000000010000000000000100000001110100000000110000000001000000001000000100

Primer Forward: TGTGGATTTCTCAAGGTCG

Primer Reverse: TGATGTAAATGGAGAGTGTG

Sequence :

1 TTTTTTTTTGTCATTACATGCATTTATTTGAGAGGGAAAAGCCATACACATTTCTCTGTG
61 TTTACCAGTACAGTTTGATTAATTTAACAGGTAATTTTTAGAAATTACTAAAAATAAAGC
121 ATTACAAACATCAGGTGTGTGGGGCTCACAGAAGTGTGGATTTCTCAAGGTCGAAGACGA
181 TCTGGATGTAGAGGCCGACGTCTGCTTTTTCCGAGACGCTCGGGAGAAAAAGAGAAAGAA
241 CCAAAACCACAGGAATGGTGGCGAGTACTACATTGATCAGGTCAAGCTTCTCTCGAGGCA
301 AAGTGTAGTCTCTAGTGTCTCCAGCAGGCGGTAGCCTCACAACTTTAGTGTTTTCTTTAT
361 GAAGTCTCATAATCCGGCTGCCCCAAAACACACTCTCCATTTACATCATATATACTCTCT
421 AGAGCTCCAT

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.