Results retrieved:


Marker 'fc20b04.x1' ----- Marker No.: 21187
is located at LINE: 292, LINKAGE GROUP 3
Its scores are:
0101000000000000000000000000000000000000000001100000100100000100000110001110100000000000000001

Primer Forward: GCAGAACAAATACGACCAG

Primer Reverse: TTTCATAGATGTTTGCGGAG

Sequence :

1 TTTTTTTTGGGCAATAAAAAAGTATTTATTCAAGAATTTAAAGCAGAACAAATACGACCA
61 GATACAAACTGAAAAAACCTATACATAAAATTAAGAGCAATTTCTGTGAGACCATGGCAG
121 ACATTCCCATTTATAAGCAGGTGTCATATTTTCTGTCTTTGTTCCTGCTGTAAAATAAGG
181 GGCAACTGTACGATTTGTAAACGATCCATGTACAGGACCAAATATGAAACAAAATGTACA
241 TGATGAAAATAAAGTAGCAGAGAAATTAAAGGGAAGACCAATACAAAAAGAATGTTACAG
301 ATAAATGTACTAACCCATGAAACGTTACTATTGTACTCCGCAAACATCTATGAAAATGGA
361 CATAACAGTACTAAAACAACCCCAATAACTCCAACAAACAAATACTTATCTTTGACTGAA
421 ACTACACTGTATTATAATACAGTGCTTCAGTCAAGAAATCCCCTCCCAGTTATGGTCATT
481 TGATATCAAAATAATGTTAGACAGGGAATTCAAATGCATCATTAAGCTAAT

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.