Results retrieved:


Marker 'fb76e02.y1' ----- Marker No.: 15127
is located at LINE: 301, LINKAGE GROUP 3
Its scores are:
0101000000000000000000000000000000000000000000100000100000000110000110000110100100000000000000

Primer Forward: CGCAAATGCCTTGTTGATGCC

Primer Reverse: TAACTCACTGTGCTTAACCACC

Sequence :

1 NTTTTGAAAAGCGTGTTTGCCTGCAGCTACCGGTCCGGAATTCCCGGGTCGACCCACGCG
61 TCCGGGATGAATAAATGAGGATGCAGTTTTCATTTTTGGGTAAACCCTCTCTTTAAGGTA
121 TTCTGAGAGGTTTTTAAAATGTTGGTACATGGATGATCAGTGGGGTTTCCTTTAAAACAG
181 TATAACTCACTGTGCTTAACCACCAAAGTATAGTGCATCATTGGAAGACTTAACAAGCTT
241 GGTTTCATGAAATCATATATGGTCATACCTCCACACTTATTTAAATTAAAGGGCATTCTG
301 TGGTTTTGATTAAATGAACTATAAAAATATCTCGATTGTAATGAGTGATTATTTGAGTCA
361 CTGTTGCCTTTCTATTAGCTGAAACCAGTCTGGCCAATTTCTCTGACCTCTGGCATCAAC
421 AAGGCATTTGCGCCCACAGAACTGCCGCTCACTGGATAGTTTCTCTTTTTCAGACCATTC
481 TCTGTAAACCCTAGAGAATGGTGTGGTGAAAATCCTAGTAGAATAAGTTTCTGAAATACT
541 CAGACCAAGCGGTCTGGCACCAACAAATTTTCCACATTTAAAGTCACTTAAATCAACCTT
601 TTTCCTCCTTTTCTCATTGCCCCAAACCACTTTTCAATTTAGAACCTATCCTTAAGGAAT
661 TAAACCGGGATGGTTGTTTTATGTAGCTTTCCAAAAAAAAAAACCCCTTTCCCGAATTTC
721 CATAGGCCCTACCATTGCCTGGGAAACCTTTTTAGTCTTTTAAACCGGGAGGCCTTTTGG
781 GTTTATGGGGGGGGAAAATAACCCTGGTCTTATTCAAAAANATTTTTATGTAACAAAAAC
841 CCGGGGTTTTCTGCAGAN

For more information, please visit the following web sites:

Wustl zebrafish search