Results retrieved:


Marker 'fb73g06' ----- Marker No.: 7723
is located at LINE: 108, LINKAGE GROUP 3
Its scores are:
0100000000110110001111000000100000000000000000110000000000000000010111000110100100000000001000

No Primer Forward available yet.

No Primer Reverse available yet.

Sequence :

1 GGACGCGTGGGCGCCGTCAGTGTGGTCAGGACTCACGCTTCACACATTTTAGGTTGCTGA
61 GAGCTTAACCAAAGTTGTTGGAAAGATGTCATGGCTGGTGTTGTCTTTGGTAATACTTAC
121 ATCTGGACTGGTTCAGTATGGCCAGTCGGCTCTGGATGGGACAGGATTGGACCCCGAAGT
181 TAACATGAACATTAGTGAAATTATCAGACACTGGGGTTACCCTGCTGAAGAATTTGAGGT
241 GGTCACTGAAGACGGATACATCCTGAGCATCAATCGAATCCCACATGGAGTCAAAAACAA
301 AAATGAAGAAGTCAAGCCTGTAGTGTTTCTCCAACACGGTCTTCTCGCTGCTGGAAGTAA
361 CTGGGTGACAAACCTGCCCAACAACAGTCTGGGATTCGTTTTAGCTGATGCTGGATTTGA
421 TGTATGGATCGGGAACAGTCGCGGGAACACCTGGTCCTGCAAACATGTCAGCCTTGACCC
481 AAGACAGAAAGAATACTGGA

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.