Results retrieved:


Marker 'fb11c02.u1' ----- Marker No.: 7965
is located at LINE: 50, LINKAGE GROUP 18
Its scores are:
0000101001001000000000001001000000100000000000100000001100000100010100001000000100000000001100

No Primer Forward available yet.

No Primer Reverse available yet.

Sequence :

1 GGAAGTTAAAAGTGGTAGAAAAGTATATTATTGCAGAGTTTTTTTTGTATAAATATTTGT
61 AGTATGTTTGTTTATTTTTCTGGATGAAATTAATCTTGACTAGGGTGTTTCCCCAGCACA
121 ATTATGTTTTGTTTTTCTGCAGGTTTGTCCTGCGTGTCTGTACAGTAAATATAGACATTC
181 CATACGTTTATAAGTATGAGCCACTGTCCACCGACTGCTTTCAGACAAACACACACTCGC
241 CCTCTTCAGCTTTTATTTTTACTGCGCTTTTGTTTTGAACACTTTCCCCTGCAAAGCATT
301 CGCTGTAATGTTTTTACGATGGAACAAAAAGATGGAACTATNNTTGTNTNTNNTTNNTTN
361 GGGGGTTNNTTTNNTTNTTTTTTTTTTTTTTTTTTTNNTTTGGGGGGGGGGGGGGGNTTT
421 TTTTTTTTTTTTTCACATTTGAATTTGTGAATACATTAATAAAAACTTTCCCA

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.