Results retrieved:


Marker 'fb09a04' ----- Marker No.: 8404
is located at LINE: 71, LINKAGE GROUP 18
Its scores are:
0001000000001000000001000010000000100000000001000000100000000100010100011000011001001000000100

Primer Forward: CAGACAACCAGAAGCCGAC

Primer Reverse: TGCCAAGGGATTTGGGCAC

Sequence :

1 TCAATGTTTTTCAATTTTTATTGATGATTTTGTTTTTTTGGGAAAAGTTGCGCTCAGCCT
61 TTAAAAATAAACAAAAATGAACAGGTTGTTTTACAACAGGTCATCCCCATAACCTGCTAA
121 CCAAGCAACAGACAACCAGAAGCCGACCAACGGGAAAAGGGGTTGGGTGTCGGTTTTTGG
181 TAGTTTTTGTTTTTGTCGGTTGCTTCTAGCTTTTCTGGGGCTTCATCAGCGGGTCATGGA
241 CCTGGCGCTGTACACTGCAGGTCCACTGAACCCCGGCCAGACATCCAGGGAATGTGCTAG
301 AACAGGGCAGCGGACACGAGTGCCCAAATCCCTTGGCAGATTGGTT

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.