Results retrieved:


Marker 'fa56d01' ----- Marker No.: 8245
is located at LINE: 149, LINKAGE GROUP 18
Its scores are:
0001101000001010000000010000010000100000000000000000100100000100110000001000011000011000001101

Primer Forward: TTCTTGCACAGCTCTGTCC

Primer Reverse: GAGAGTGAATGAAATGAGCC

Sequence :

1 CCCTCAACAAGTAACATCTGATTTTACAGACGGCATAGCAGCAGTAGTGTTTGTTGCACA
61 TCTACACTTTTTTCACATTGGTTTTTACTCGACAAGTAGTGAAACACATTTAAATAATGA
121 TTTAAGACTTTTTATAGATATAAAAACTACATAAAACCTACACTGCATAACATGATGCTT
181 AATGGTATATTTTCTTGCACAGCTCTGTCCATTTTGAGGCTAAAATCCTGAGCTAAAAGA
241 ATCTCTCTTATATTTTTTGTTTAATAAATAGAATGACAAAGCTTATTTTGCTTTAGTTTT
301 TTGTTTATATCTCCTTTCATAAAATATTTTGTGAAACTCAATTGACAAAAATAAAAAAAG
361 GAGCCAATGGAATAACAAAATATTCACATAAAAAAAAAAAACTAATATTTTCCCTATGTA
421 AAATCTGGCTCATTTCATTCACTCTCATATAAATCTTCTTTTTTTTC

For more information, please visit the following web sites:

Zon Lab wz FASTA database.

NCBI nucleotide database.