Results retrieved:


Marker 'fa18f07.s1' ----- Marker No.: 4547
is located at LINE: 112, LINKAGE GROUP 3
Its scores are:
0100000010110110001111000000010000000000000000110000000100000000010110000110100100000000000000

Primer Forward: AACCAAAACAACAGCAACAGC

Primer Reverse: CGAAACCAGGATGCAAATAAA

Sequence :

1 TTTTAATATAAATGAATAATTGTTTATTGATTATTTTCTCACTTCGCCGTTTGTGAATCA
61 CAAAGGCTTTCCTTCTGCCACGAACAAGAACAAAACACATTCAAACCAAAACAACAGCAA
121 CAGCACAGTCAGTCCTGCAGCAGCAGAGGGAGATATTAATGTTGATCATCCTTATAATAA
181 CACACACTGACAGCACGGTCTGTGTGTTTCACTACTCGAAGCACAATTTAACTTTACAAG
241 CTATTCAGATCAATTTCTGCATGTGGAGAACTCAACTGAACCTGCTTACGTGTGTTTTGA
301 ATGATATCATCTCAAAATTACCAGAGAAAAACATTTGAAATGCAAATTTTTGTGCATTTT
361 ATTTGCATCCTGGTTTCGTTTTACTCTTTCCAAAAGCTGAAACCAGCATGCGGCACTTCA
421 TACTTTCA

For more information, please visit the following web sites:

NCBI nucleotide database.