Results retrieved:


Marker 'fa10c03.s1' ----- Marker No.: 3989
is located at LINE: 241, LINKAGE GROUP 18
Its scores are:
0110001000001210000000010000010000000000000100000001110000000101001000101000000100000000000000

Primer Forward: AGGACTTTACACGTACAATGGC

Primer Reverse: GACTGAAACGATCCCGATCATG

Sequence :

1 TACTTAATCTTCTCTTTATATTATTACAGGACTTTACACGTACAATGGCTAAACTCCACA
61 CTGTGTAGAAGAAACAGACAAAAATATAGTCAACAAAATAAACAACAAAGAAAATAAAGG
121 TTTCTCATCCAAAAAAAAAAAAAGCATAAATAATATAAAAGAAACTTTTTTTCTTACAAC
181 AGATACATTCATATGAAATAATATTTTACTACTACAAAAAATAAATAAGTCATCTAAAGA
241 GTTTTTTTGTGTTGACTTTTTTTTTTAACGTCCTCCCATGATCGGGATCGTTTCAGTCTT
301 TGATTCCACCAATATCTTCATTCGTTTCATCTC

For more information, please visit the following web sites:

NCBI nucleotide database.