Results retrieved:


Marker 'bz85b22.z' ----- Marker No.: 13333
is located at LINE: 79, LINKAGE GROUP 18
Its scores are:
0001000000001000000000000010000000100000000001000000100000000100010000011000011100000000000100

Primer Forward: ggtgcctcttttctgctctg

Primer Reverse: tgaccagcaaatccacttga

Sequence :

1 GAGGCTACTTCCAGGGNAATTCATTTAGGGCGTGCATATTAGTGGGTGCCTCTTTTCTGC
61 TCTGAATTAGTCCATTCGTCAATCTTTTAAACAAATAAAATTGTGTATCAGCCTACATTT
121 TTTCTAATTTCATGACCATTTCAAGTGGATTTGCTGGTCATATAATTAGAATATCTTCAA
181 ACAGTTGGTTTATTTTACTAATGCCATTCAAGAAGTGAAACTTGTATAATGTATATATTC
241 ATTCCACACAGACTGATATTGTTTCAAGCATTTATTTATTTTAATTTTGATAATTTTGAT
301 GAACAAATCAAAACCTTAAATTCAGTGTCTCAGAAAATTTGAATATTGTAAATGCGTTCA
361 TTAGACACAAGGAATGTGACAGCTGAAACCCATGTCTTGCATACGTCTGTGAGTAGTGGG
421 CTCTTGAAGCACTGACTCCAGATGCAGTCCACTCTGTGAACCTGCCCCACATTTCTGAAT
481 GGGNTTTGGCCCCCACTCCTCTCCCCGGTGCACTCATCCCGACTGCTTGTTCACCCTCCA
541 TCTCTACACCTCCCCTTTCCCCCCCCTCCCTATACTGTGCTCGCCAGACCCTCGCCTCTC
601 TCTTTCCCCACCCCTATTTTTTTCCGCGTCTCACCCTCCCTTCCCTTCTCCTCATCCTCA
661 TCTCCTCTCCCCCACCCCTCCTCTTTCTTCCCCCTCCCCCTCCCTTTCTCTTCCTTTCTT
721 TTTCTTCTTTTTTTCTCTCCTTCCACTTCTCTCCCTCCCTTCTTCTTCCCCCTCCCCCTT
781 TTCCTCCCTCCTCTCCCACCTCCCTCTTCCCTCTCCCCTCCCTTTTTCCCCCTCCTTCCC
841 CTCTCCCCTCCCTTTCTCCTCCACGTTCTTCTTCCGCCCCTTCACCCTCTCTCCCTTCA

For more information, please visit the following web sites:

no more information available yet.