Results retrieved:


Marker 'bz2n10.z' ----- Marker No.: 12525
is located at LINE: 153, LINKAGE GROUP 3
Its scores are:
0100000000000000000000000000000000000000000001100110100000000000100110000110100101000000001000

Primer Forward: cagtcatggagcagcactgt

Primer Reverse: gtgaggtgtgcgagacagaa

Sequence :

1 TAAGGATCACATAGGGAATTATAAAAACATTTTTCTTAAAAAACTGCTTCAGGCAATTGT
61 CAGAACTTAAAACACAGTAAATGACAGTCATGGAGCAGCACTGTGGTCTCTGTAAAACTG
121 CAGTTTCTGTGTCACCTCTATTTAATGTGCAACCTTTGTAAGAAGCCCTCTGGGACCTTA
181 AGGAGCTCAGCTCTTCTTCAGTAAAACATGTCCACAGGTGACAGCTAAAGAGCTCGATTC
241 TTCTGTCTCGCACACCTCACACTCCAGCTTTCACAGCCCATTCACACCAAGTGACCTTCA
301 CAAAATCTGACATAGCACTGACTTACACACTTGTCTCTTTCTCTTTACTTATAGACTAAA
361 AGGAGTTTAAGAGAATTCAAATTCGACATTAGTGAATATTTTTATTGCAAATATTAATAA
421 AAATGTGCATTGTGTTAAACGACAAATCGATCCTTACCTTCCGATTGAGACTGGTGAGTG
481 AGCCAGGCCGCAGAACTCTGCGTTTCCTGTATGAGAGAAGAGGTCGTGTGCGGGCTGCCA
541 CACACGTGTTGTCATTCGTAGGGAAGGGAACAGACCCTAAACGGCTCTGTTCATCCAGGT
601 CTGAGGTGACAGGGGAATCCGACCGGAAGCTAGAGAGAAGAACANAATTATCAACAATAA
661 AAAGGATTCTTTTGGTGGTCATAAAGGCTTTAATGAAGTCAAAATAAATAAAGGAAGCTT
721 TTAATAACATTATATGCATAGCCTAAAATAGACAATCCCTAAAGCACAAATGTCAGTGAC
781 TATGTGAAAATGATTCACCTGTACTCTCTTTTCGCAGG

For more information, please visit the following web sites:

no more information available yet.