Results retrieved:


Marker 'af401485' ----- Marker No.: 6806
is located at LINE: 422, LINKAGE GROUP 3
Its scores are:
1100000000111000000000000000000000000000000100000001011100000100000000000000001001000000000000

Primer Forward: ATGCGATTAGTCACGATCAACTGT

Primer Reverse: GCCCTGAAATACATTTAAGTTGTC

No Sequence available yet.

For more information, please visit the following web sites:

Wustl zebrafish search